Current Level

 Primer Answers

Previous Level

 BioWeb Home
 Primer Design 1
 Primer Design 2
 Primer Answers

Upon aligning the two sequences you would get the results below. 

A vertical line indicates that the base is conserved in the two sequences, the absence of a line indicates a change.  This makes it easy  to identify conserved regions which would be good sites for a primer to bind to both sequences.

There are many possible answers to this problem.  The two below are not necessarily the best, try several primer sequences to see which work best.

The sequence ccttggcctctgcct would make a good first primer.  There is only one mis-match.  However, it only has a Tm of 54oC and forms a hairpin and dimers.

Instead, the sequence gccttctcctccgtcgccc is 74% GC with a Tm of 63oC and doesn´t form hairpins or dimers.  This would be a better primer, but the PCR product would be about 100 bp shorter.  This would make a decent Primer 1.

Similarly the sequence cgatgtaggggaaggcggaaag  is 59% GC with a Tm of 61oC and doesn´t form hairpins or dimers. This would make a good Primer 2.

 

Query: 1   ccttggcctctgcctaatcacacagattctaacaggattatttctcgcaatacactacac 60
           ||| ||||||||||| || ||||| ||  |||||||| ||||||| ||||||||||||||
Sbjct: 1  
cctaggcctctgccttattacacaaatcttaacaggactatttcttgcaatacactacac 60
 

               Primer 1  5´gccttctcctccgtcgccc 3´
Query: 61  agctgacatctcaaca
gccttctcctccgtcgcccacatctgtcgagatgttaactacgg 120
           ||||||||| |||||||||||||||||||||||||||||||| ||||| || ||||||||
Sbjct: 61  agctgacatttcaacagccttctcctccgtcgcccacatctgccgagacgtaaactacgg 120

                                                                      
Query: 121 atgactaattcgaaacattcatgcaaacggagcctcctttttcttcatctgcctctacct 180
            |||||||| |||||| | || ||||| || |||||||| ||||| |||||| | |||||
Sbjct: 121 gtgactaatccgaaacgtccacgcaaatggcgcctccttcttctttatctgcttgtacct 180

                                                                      
Query: 181 tcacgtagcccgaggcatatactatggctcatacctctacaaagaaacctgaaacatcgg 240
           |||||| || ||||| |||||||| ||||| |||||| | ||||||||||||||||||||
Sbjct: 181 tcacgtcgcacgaggtatatactacggctcctacctccaaaaagaaacctgaaacatcgg 240

                                                                      
Query: 241 agtagttctcctactcctaactataataaccgccttcgtaggatatgtgctcccatgagg 300
           |||||| ||| ||||||| || |||||||||||||||||||| ||||| || || |||||
Sbjct: 241 agtagtcctcttactcctcaccataataaccgccttcgtaggctatgtactgccctgagg 300
 

                                      Primer 2   3´gaaaggcggaaggggatgta
Query: 301 acagatatccttctgaggagccaccgtaattaccaaccttctttccgccttcccctacat 360
           ||| ||||| || ||||| || |||||||| || ||||| |||||||||||||| |||||
Sbjct: 301 acaaatatcattttgaggggcaaccgtaatcactaacctcctttccgccttcccgtacat 360

          
gc 5´                                                    
Query: 361 cggggacaccctagtacaatgaatctgaggtggtttctcagt 402
           ||| |||||  |||| |||||||||||||| || || |||||
Sbjct: 361 cggcgacacattagtgcaatgaatctgaggcggcttttcagt 402

 

uwsa_l5

 © 2002 The Board of Regents of the University of Wisconsin System.

Click here to email comments to Scott Cooper regarding this site or its links.