 |
|
|
|
|
|
|||||||
|
Current Level |
||||||||||||
|
||||||||||||
|
Previous Level |
||||||||||||
|
||||||||||||
|
|
 |
|
|
|
Web sites: The RNA World Web site: http://www.imb-jena.de/RNA.html Tree of life: http://www.tolweb.org/tree/ ARB (downloadable program): http://www.arb-home.de/ Ribosomal Database Project (RDP): http://rdp.cme.msu.edu/index.jsp
Exercise 1 A. Sequence Match 1. Which of the sequences (>1200) in the RDP most resemble the sequence given below? 1 gacgaacgct ggcggcatgc ctaatacatg caagtcgaac gcttttgttt caccgggtgc 2. Check the information for your best match. Where was the organism isolated from? 3. What happens if you repeat the search, but use "both" to include the
short sequences as well? Is your original answer still the best match?
Defend your answer. B. Use the Hierarchy Browser (search) to find Methylomonas scandinavica. a. Does this organism belong to the domain Archaea or Bacteria? b. M. scandinavica is found in which phylum? c. M. scandinavica is found in which class? d. M. scandinavica is found in which order? e. M. scandinavica is found in which family? f. Where was this organism isolated from? g. Download the sequence to your on-line files. This will be one of the sequences used for labs 2.2 and 2.3
Probe Match (set size to "both") C. For each of the following sequences, determine: a. Which genus, family, or order of organisms the signature sequence or probe is specific for? [That is, which of these headings encompasses (contains) the bulk of the matches given.] How many "hits" (query is complementary to sequence found in this organism) fall into this category out of the total hits. Be sure the settings are correct for your entry - they will differ depending on if you are entering a signature sequence or a probe sequence. b. For each of the following, how many sequences within the genus (or family or order) aren't complementary to the signature sequence/probe?
Possible Signature sequences (- strand, 5'-3'): 1. TAGAGTGCAGCAGAGGGG 2. ACTAGGTGTYGCGGGTA Possible Probes (+ strand, 5'-3'): 3. CTTCCATACTCTAGGTAC 4. ACCGAGGTACATGTACCCCGACAT
D. Which of the 4 sequences above would work the best for a genus-specific probe (or signature sequence)? Defend your answer. E. When you run Probe Match the size default is "both". Why do you suppose you'd want both instead of just >1200 or <1200? When set to "both", if the results show your probe hits 23 of the 52 sequences, does this mean that 29 organisms have sequence with mismatches to the probe in the region of the 16S rRNA where the probe is targeted? Defend your answer. F. Look back at your results for signature sequence 1 above (i.e. matched it in Probe Match). Was the probe complementary to sequence from all members in this group (with no mismatches)? Probe match allows you to restrict your search by entering a region of the sequence that should contain your signature sequence/probe target. This narrows the search to only include the sequences in the database which contain the target region complementary to your probe. Note: it still checks the entire sequence though and not just the region entered. Run Probe Match again setting the region to 650 to 680. How do these results compare to those you had before? Why are they different? What do these results tell you about the utility of the probe compared to what you knew before?
(Do not hand in this next part. These sequences are needed for Lab 2.2 and so you need to have found these sequences before you can do this next lab. Be sure to use appropriate nucleic acid databases and not protein databases - otherwise you can use any database you prefer. ) Find the following rRNA sequences (or the rRNA gene sequences) and download or copy the sequences into Biology Workbench. (Note most of these aren't in the RDP currently as they are still preparing the Eukarya section and so you should use either Workbench or Blast to retrieve the sequences.) For some of these there will be more than one option to chose from. Please select complete or close to complete rather than partial sequences if possible (about 1500 nt for 16S, over 1400 to preferably close to 1600 for the protozoa and at least 1700 nt for the other 18S, although 1900 is better ) and do NOT use sequences which also contain other genes or spacers. We will be using these sequences to perform multiple alignments and create phylogenetic trees and the sequences you select can affect your results. Mouse 18S rRNA Methylomonas scandinavica 16S rRNA Human (Homo sapiens) 18S rRNA Xenopus laevis 18S rRNA Cimicifuga acerinaa 18S rRNA Chlamydomonas nivalis 18S rRNA Trichomonas tenax 18S rRNA Giardia intestinalis 18S rRNA Methanococcus jannaschii 16S rRNA Escherichia coli 16S rRNA Pyrodictium occultum 16S rRNA
|
|
|
|
