 |
|
|
|
|
|
|||||||
|
Current Level |
||||||||||||
|
||||||||||||
|
Previous Level |
||||||||||||
|
||||||||||||
|
|
 |
|
|
|
Web sites: The RNA World Web site: http://www.imb-jena.de/RNA.html Tree of life: http://www.tolweb.org/tree/ Silva: http://www.arb-silva.de/ Ribosomal Database Project (RDP): http://rdp.cme.msu.edu/index.jsp
Exercise 1 A. Sequence Match 1. Which of the sequences (>1200) in the RDP most resemble the sequence given below? 1 gacgaacgct ggcggcatgc ctaatacatg caagtcgaac gcttttgttt caccgggtgc 2. Check the information (GenBank flat file accessed via S00 number)
for your best match. What habitat was the organism
isolated from? B. Use the Hierarchy Browser (search) to find Methylomonas scandinavica. a. Does this organism belong to the domain Archaea or Bacteria? b. M. scandinavica is found in which phylum? c. M. scandinavica is found in which class? d. M. scandinavica is found in which order? e. M. scandinavica is found in which family? f. Where was this organism isolated from? g. Download the sequence to your on-line files. Remember to change the defaults to FASTA format and Remove all gaps. You can download multiple files at once in a FASTA format that is compatible with many alignment and other programs. Note this file can only be opened by specific programs and so you will not be able to just click on it to see its contents. This download technique will be useful to you for your take-home. As this is only one of the sequences you will use for labs 2.2 and 2.3 and the other sequences will come from from other sources, you also will also need to copy and paste the FASTA version of the sequence (hover on S00 number of the sequence and this option should pop up, click on it to get to the file - note when you copy be sure to include the top line with the name and identifier) to a text document (not a word processing one like Word, as once saved it will have formatting that the programs we use can't handle).
Probe Match (set size to "both") C. For each of the following sequences, determine: a. For which genus of organisms is the signature sequence or probe specific? [That is which genus encompasses (contains) the bulk of the matches given.] How many "hits" (query is complementary to sequence found in this organism's rRNA) fall into this category out of the total hits. Be sure the settings are correct for your entry - they will differ depending on if you are entering a signature sequence or a probe sequence. b. For each of the following, how many sequences within the genus aren't complementary to the signature sequence/probe?
Possible Signature sequences (- strand, 5'-3'): 1. TAGAGTGCAGCAGAGGGG 2. GATGTGGAGCGAACCTGAGA Possible Probes (+ strand, 5'-3'): 3. CTTCCATACTCTAGGTAC 4. ACCGAGGTACATGTACCCCGACAT
D. Which of the 4 sequences above would work the best for a genus-specific probe (or signature sequence)? Defend your answer. Provide at least 2 reasons for your choice. E. When you run Probe Match the size default is "both". Why do you suppose you'd want both instead of just >1200 or <1200? When set to "both", if the results show your probe hits 23 of the 52 sequences, does this mean that 29 organisms have sequence with mismatches to the probe in the region of the 16S rRNA where the probe is targeted? Defend your answer. F. Look back at your results for signature sequence 2 above (i.e. matched it in Probe Match). Was the probe complementary to sequence from all members in this group (with no error)? Probe match allows you to restrict your search by entering a region of the sequence that should contain your signature sequence/probe target. This narrows the search to include only the sequences in the database that contain sequence data in the target region complementary to your probe. Note: it still checks the entire sequence though and not just the region entered. Run Probe Match again setting the region to 1240 to 1290. How do these results compare to those you had before? Why are they different? What do these results tell you about the utility of the probe compared to what you knew before?
(Do not hand in this next part. These sequences are needed for Lab 2.2 and so you need to have found these sequences before you can do this next lab. Be sure to use appropriate nucleic acid databases and not protein databases - otherwise you can use any database you prefer. ) Find the following rRNA sequences (or the rRNA gene sequences) and copy and paste a FASTA file of the sequence to the text file you started above in B (reminder - do not use a word processing program like Microsoft Word). Note most of these aren't in the RDP currently as they are still preparing the Eukarya section and so you will need to look elsewhere to retrieve most of these sequences. For some of these there will be more than one option to choose from. Please select complete or large partial sequences rather than small partial sequences if possible (about 1500 nt for 16S, over 1400 to preferably close to 1600 for the protozoa and at least 1700 nt for the other 18S, although 1900 is better ) and do NOT use sequences which also contain other genes or spacers. The protozoa files may refer to these as 16S or 16S-like as they are much smaller than typical 18S rRNA. We will be using these sequences to perform multiple alignments and create phylogenetic trees and the sequences you select can affect your results. Methylomonas scandinavica 16S rRNA (already retrieved above in part B) Mouse 18S rRNA Human (Homo sapiens) 18S rRNA Xenopus laevis 18S rRNA Actaea japonica 18S rRNA Chlamydomonas nivalis 18S rRNA Trichomonas tenax 18S rRNA Giardia intestinalis 18S rRNA Methanocaldococcus jannaschii 16S rRNA Escherichia coli 16S rRNA Pyrodictium occultum 16S rRNA
|
|
|
|
