Current Level

 ORF
 Pedigree and gel

Previous Level

 BioWeb Home
 Problems
 Intro Lecture
 ORF

Normal B-hemoglobin gene sequence showing start and stop codon locations

    ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCAC CTGACTCCTGAGGAGAAGTCTGCGGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGA AGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCT TTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAG GCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCT CAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCT GAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAA AGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATG CCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTC CTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCT GGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

uwsa_l5

  2002 The Board of Regents of the University of Wisconsin System.

Click here to email comments to Scott Cooper regarding this site or its links.