Current Level

 Problems
 Intro Lecture

Previous Level

 BioWeb Home
 Replication
 Transcription
 Translation
 PCR
 DNA synthesis
 DNA sequencing
 Translation Lecture

Translation Lecture Demonstration

This demonstration uses human beta globin to show the mutation that causes sickle cell anemia. It is intended to supplement a lecture on translation and introduce students to bioinformatics and the use of the Biology Workbench http://workbench.sdsc.edu/.

Teacher Preparation:

Enter Biology Workbench and create a session called translation demo. Enter the Nucleic Tools section. Select Add Nucleic Sequence. Copy and paste the human beta globin (GBPRI:29436) cDNA sequence into the file. Select save. Repeat the process with the sickle cell cDNA.

>normal B-hemoglobin 29436

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCG GTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGA AAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGT GACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGA ATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTC GCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCT TGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

>sickle-cell B-hemoglobin

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGTGGAGAAGTCTGCG GTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGA AAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGT GACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGA ATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTC GCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCT TGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

Check the human beta globin sequence and select SIXFRAME, select "show longest open reading frames" and then select RUN. This program translates the cDNA in all three reading frames.

The longest reading frame is in the bottom window. Unclick all of the other reading frames and Import this protein sequence. It will now appear under Protein Tools. Repeat this with the sickle cell cDNA. This will give you both cDNA and both protein sequences in your folder in case something unexpected happens in class.

Before class have two web browser windows open, one with Biology Workbench and one with Protein Explorer tutorial of hemoglobin http://www.umass.edu/microbio/chime/hemoglob/2frmcont.htm.

Background material that should be discussed before this lecture:

Options:

Demonstration  (answers to questions are in italics)

    1.  After introducing translation tell the students that you will be doing a demonstration to illustrate translation.

    2.  Select the biology workbench page and nucleic tools.

    3.  Check the human beta globin cDNA and select VIEW and discuss its size.

      a.How large is it? 626 bp

      b.How large a protein could it encode? 626/3 = 208 a.a.

    4.  Translate the cDNA by selecting the box next to human beta globin cDNA and then choose SIXFRAME. Next select "show longest open reading frames" and then select RUN.

    5.  Analyze the results and discuss with class.

      a.  Which reading frame had the longest protein? Frame 3

      b.  Frame 4 is fairly long, but is not considered the longest protein. Why? No Methionine at the beginning.

      c.  How long are the shorter proteins? 10-30 a.a.

      d.  Why would you predict these to be short? There are 3 stop codons out of a total of 64 codons. Thus you would predict a stop codon every 20 codons.

      e.  Why did we pick the longest reading frame? It does not have any internal stop codons and has a start codon and therefore probably encodes the complete protein.

      f.  Is the longest protein 208 a.a. long? Why not? Go back to frame 3 of the translation and look at the amino acids that are not included in the final protein. It is 147 a.a. long.

      g.  The start and stop codons are highlighted in the attached image.

    6.  Import the translation. It will be in your Protein Tools section.

    7.  Go to the Protein Explorer window and examine the normal human beta globin. http://www.umass.edu/microbio/chime/hemoglob/2frmcont.htm

    8.  You can stop here if you would like, or go on and examine the sickle cell mutation.

    9.  Go to Protein Tools and select both the normal and sickle cell cDNA. Explain to students that you have already translated it.

    10.  Select ClustalW to align the two protein sequences. Your alignment will be in the Alignment Tools section.

    11.  Scroll down and look for the mutated amino acid

    12.  Go to the Protein Explorer window to examine the structure of the sickle cell hemoglobin.

    13.  You can stop here or back to the DNA sequences and align them to discuss mutations in DNA.

    14.  Go to Nucleic Tools and select both the normal and sickle cell cDNAs. Select ClustalW.

    15.  View the alignment. Can you find the mutation in the DNA that caused the mutation? What kind of mutation is this? A substitution.

    16.  Select the normal human beta globin sequence and select Edit. Add or delete a base after the start codon and save the file.

    17.  Select the newly edited file and translate it using SIXFRAME. What impact did this have on frame 3 of the protein? Is it still 147 a.a? Probably not.

    18.  What kind of mutation was introduced? A frameshift.

    19.  What impact would this have on the function of the protein? It might not be made at all and would not function.

    20.  You can stop here or proceed on to RFLP analysis.

    21.  RFLP stands for Restriction Fragment Length Polymorphism. A model of a restriction enzyme can be found at: http://www.worthpublishers.com/lehninger3d/index.html

    22.  Restriction enzymes are like spell checking enzymes, they look for specific "words" in the DNA and then cut them. If the "word" is misspelled, then the enzyme will not cut the DNA.

    23.  We will use the enzyme DdeI. It cuts the normal beta globin cDNA at CTGAG, but it will not cut the sickle cell cDNA at CTGTG.

    24.  Go to Nucleic Tools, select the normal beta globin and then select TACG. This program will allow you to digest the DNA with different enzymes.

    25.  Scroll down to User Specified Enzymes: and type in DdeI. This enzyme will cut the normal cDNA at the sequence CTNAG (N can be any nucleotide) but not the sickle cell mutant. Scroll down to Smallest Fragment Cutoff Size for Simulated Gel Map: and change it to 10. Select Submit.

    26.  You will get the following output.

      DdeI C'TnA_G (0 Err) - 7 Fragment(s)

      37 50 68 84 89 139 159

    27.  The enzyme will cut the normal cDNA 6 times, giving 7 fragments of the indicated lengths. You can draw these on the board, or use the image a the end of this unit.

    28.  Repeat steps 24 and 25 with the sickle cell sequence and compare the two.

    29.  You will get the following output:

      DdeI C'TnA_G (0 Err) - 6 Fragment(s)

      37 50 84 89 139 227

    30.  Note that the 68 bp and 159 bp fragments are no longer present, and have combined to form a 227 bp fragment.

    31.  Use the data that you just collected to decide which of the following individuals would have sickle cell anemia (ss) and which would be carriers (Ss).  You will need to examine the attached pedigree and DNA gel.  Each sample was digested with DdeI

 

    Key for gel and pedigree

        1 Ss

        2 Ss

        3 ss

        4 Ss

        5 Ss

        6 SS

     

    Developed by:  

    Paul Lock, Urbana High School

    Peggy Maher, Austin Community College

    Scott Cooper, University of Wisconsin-LaCrosse                                     

 

uwsa_l5

  2002 The Board of Regents of the University of Wisconsin System.

Click here to email comments to Scott Cooper regarding this site or its links.