Current Level

  Answers

Previous Level

 BioWeb Home
 Problems
 Intro Lecture
 Translation Answers

1.  First identify the start codon in the open reading frame.  Then break the sequence into 3 base pair codons until you reach a stop codon.  Finally translate each codon into its corresponding amino acid.

GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA   DNA

                   AUG CCC CUU AAA GAG UUU ACA UAU UGC UGG AGG CGU UAA    mRNA

                   Met   Pro    Leu  Lys    Glu   Phe  Thr     Tyr   Cys   Trp   Arg   Arg   Stop           Protein

 

2.  First write the complementary strand of DNA.  Next look for the longest possible ORF in both strands, reading each in a 5 to 3 direction.  In this instance the longest open reading frame is in the reverse orientation (strand 2).  Strand 2 will be the sense strand and Strand 1 the antisense strand

Strand 1     5'  TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT  3'

Strand 2     3  AGTTACATTGCGCGATGGGCCTCGAGACCCGGGTTTAAAGTAGGTGA   5

1         S  M  *  R  A  T  R  S  S  G  P  K  F  H  P                          

2          Q  C  N  A  L  P  G  A  L  G  P  N  F  I  H                         

3           N  V  T  R  Y  P  E  L  W  A  Q  I  S  S  T                        

4           *  H  L  A  S  G  P  A  R  P  G  F  K  M  W                        

5          E  I  Y  R  A  V  R  L  E  P  G  L  N  *  G                         

6         K  L  T  V  R  *  G  S  S  Q  A  W  I  E  D

 

mRNA    5 AGUGGAUGAAAUUUGGGCCCAGAGCUCCGGGUAGCGCGUUACAUUGA 3

Protein    N- Met Lys Phe Gly Pro Arg Ala Pro Gly Ser Ala Leu His -C    

uwsa_l5

  2004 The Board of Regents of the University of Wisconsin System.

Click here to email comments to Scott Cooper regarding this site or its links.