Current Level

Previous Level

Practice problems on PCR and site directed mutagenesis are given below.  For a review of the theory behind primer design click here. 

1.  Draw the products of three rounds of PCR amplification.  For each product clearly indicate the length, orientation and the position of the markers on each product.  Assume you have an unlimited supply of both primers.

2.  Design primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA).  The primers should be 15 bases in length.  Indicate the 5' and 3' ends of the primers.

  5'  GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA  3'

What other reagents are necessary to perform a PCR reaction?

PCR machines cycle between three temperatures.  What is the purpose of each stage in the PCR cycle, and roughly what temperatures are used?

After 10 rounds of amplification approximately how many molecules of the amplified region should you have theoretically.