Current Level

 Seq Editor
 Searches
 Seq. Comparison
 Alignment
 Restriction Map
 Translation & ORF
 Reverse Comp
 Primer Design
 Splice Sites
 Genomics
 Protein Motifs
 Protein structure
 Transmembrane

Previous Level

 BioWeb Home
 
 Seq Anal
 Theory
 Bioinformatics
 Mo Bio Lecture
 
 Reverse Complement

Often we need to obtain the complementary strand of a DNA sequence.  As DNA is antiparallel, we really need the reverse complement sequence to keep our 5' and 3' ends properly oriented.  While this is easy to do manually with short sequences, for longer sequences computer programs are easier.

Original Sequence  5'ATGCAGGGGAAACATGATTCAGGAC 3'

Complement         3'TACGTCCCCTTTGTACTAAGTCCTG 5'

   (Pairs with Original Sequence, antiparallel)

Reverse Complement 5'GTCCTGAATCATGTTTCCCCTGCAT 3'

   (Complement sequence written 5' to 3')

 

You can easily generate a reverse complementary sequence if you are in Biology Workbench

The following program is also easy to use.  Just paste your sequence into the box and Submit the sequence.  The reverse complement sequence will be given.

 

 

uwsa_l5

  2003 The Board of Regents of the University of Wisconsin System.

Click here to email comments to Scott Cooper regarding this site or its links.