Current Level

Previous Level

What is a primer? 

A primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to DNA sequencing.  These primers are designed to have a sequence which is the reverse complement of a region of template or target DNA to which we wish the primer to anneal.   

Analysis of primer sequences 

When designing primers for PCR, sequencing or mutagenesis it is often necessary to make predictions about these primers, for example melting temperature (Tm) and propensity to form dimers with itself or other primers in the reaction.  The following program will perform these calculations on any primer sequence or pair.

IDT DNA (Select Oligo Analyzer)

The programs will calculate both the Tm of the primers, as well as any undesireable pairings of primers.  When primers form hairpin loops or dimers less primer is available for the desired reaction.  For example... 

Some thoughts on designing primers. 

1.  primers should be 17-28 bases in length;  
2.  base composition should be 50-60% (G+C);  
3.  primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming;  
4.  Tms between 55-80^oC are preferred;  
5.  3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product;  
6.  primer self-complementarity (ability to form 2^o structures such as hairpins) should be avoided;  
7.  runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.  

       (adapted from Innis and Gelfand,1991) 
          

Designing Degenerate Oligonucleotides.

AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
  C  G  C  CT CAGC  C  C   T C  C  C  G
        A     A  A           A  A 
        G     G  G           G  G 
 

One could then select the 14 base sequence (in blue) to generate a smaller set of degenerate oligonucleotides.  Each oligonucleotide in the set would have one base changed at a time (shown in purple below).  A total of 32 unique oligonucleotides would be generated.

TATTGTTGGCTTCC

TACTGTTGGCTTCC

TATTGCTGGCTTCC

TACTGCTGGCTTCC

etc.

When ordering degenerate oligonucleotides, you just let the company know that you want a mixture of nucleotides added at a specific position using the code below.  By adding the mixture, oligos will incorporate one of the bases, leading to a mixture of oligonucleotides. 

Standard MixBase Definitions
	A, G
	C, T
	A, C
	G, T
	C, G
	A, T
	A, C, T
	C, G, T
	A, C, G
	A, G, T
	A, C, G, T