|
What is a primer?
A primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to DNA sequencing. These primers are designed to have a sequence which is the reverse complement of a region of template or target DNA to which we wish the primer to anneal.
Analysis of primer sequences
When designing primers for PCR, sequencing or mutagenesis it is often necessary to make predictions about these primers, for example melting temperature (Tm) and propensity to form dimers with itself or other primers in the reaction. The following program will perform these calculations on any primer sequence or pair.
IDT
DNA (Select Oligo Analyzer)
The programs will calculate both the Tm of the primers, as well as any undesireable pairings of primers. When primers form hairpin loops or dimers less primer is available for the desired reaction. For example...
Some thoughts on designing primers.
1. primers should be 17-28 bases in length; 2. base composition should be 50-60%
(G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4.
Tms between 55-80oC are preferred; 5. 3'-ends of primers should not be complementary
(ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product; 6. primer
self-complementarity (ability to form 2o structures such as hairpins) should be avoided; 7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.
(adapted from Innis and Gelfand,1991)
Also keep in mind that most oligonucleotide synthesis reactions are only 98% efficient. This means that each time a base is added, only 98% of the oligos will receive the base. This is not often critical with shorter
oligos, but as length increases, so does the probability that a primer will be missing a base. This is very important in mutagenesis or cloning reactions. Purification by HPLC or PAGE is recommended in some cases.
Oligonucleotide length |
Percent with correct sequence |
10 bases |
(0.98)10 = 81.7% |
20 bases |
(0.98)20 = 66.7% |
30 bases |
(0.98)30 = 54.6% |
40 bases |
(0.98)40 = 44.6% |
Designing Degenerate Oligonucleotides.
A group of degenerate oligonucleotides contain related sequences with
differences at specific locations. These are used simultaneously in the
hope that one of the sequences of the oligonucleotides will be perfectly
complementary to a target DNA sequence.
One common use of degenerate oligonucleotides is when the amino acid sequence
of a protein is known. One can reverse translate this sequence to
determine all of the possible nucleotide sequences that could encode that amino
acid sequence. A set of degenerate oligonucleotides would then be produced
matching those DNA sequences. The following link will take you to a
program that will perform a reverse translation. http://arbl.cvmbs.colostate.edu/molkit/rtranslate/
For example, the amino acid sequence shown in purple below could be encoded
by the following codons.
AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
C G C CT CAGC C C T C C
C G
A A A
A A
G G G
G G
One could then select the 14 base sequence (in blue) to
generate a smaller set of degenerate oligonucleotides. Each
oligonucleotide in the set would have one base changed at a time (shown in
purple below). A total of 32 unique oligonucleotides would be generated.
TATTGTTGGCTTCC
TACTGTTGGCTTCC
TATTGCTGGCTTCC
TACTGCTGGCTTCC
etc.
When ordering degenerate oligonucleotides, you just let the company know that
you want a mixture of nucleotides added at a specific position using the code
below. By adding the mixture, oligos will incorporate one of the bases,
leading to a mixture of oligonucleotides.
Standard MixBase Definitions |
|
A, G |
|
C, T |
|
A, C |
|
G, T |
|
C, G |
|
A, T |
|
A, C, T |
|
C, G, T |
|
A, C, G |
|
A, G, T |
|
A, C, G, T |
|